Vedanta Demerger: New Shares Credited to Demat Accounts? Here’s What Investors Should Watch Before Listing Day (Image: Shutterstock) Just a day after the listing of the 4 demerged entities of the ...
Link to Best New Movies of 2026, Ranked by Tomatometer 50 Best Free Movies on Fandango (July 2026) Link to 50 Best Free Movies on Fandango (July 2026) What to Watch: In Theaters and On Streaming Link ...
The Oxygen SR3 Scout Rifle is a classic Destiny 2 weapon reprised in the Edge of Fate expansion, and the god rolls you want for PvE and PvP are wildly different. It can be effective in both modes, but ...
The fourth edition of the e4m CTV Conference is set to take place in Mumbai on June 11, bringing together industry experts, marketers, advertisers and business leaders from across the media and ...
Haier 1.5 Ton 4 Star Triple Inverter Split AC (5250 W, Copper, 7 in 1 Convertible, 4-Way Swing, Frost Self Clean, HD Filter, Cools at 60°C, 20 Mtr. Air Throw - HSU18K-PYSC4BN-INV, White)View Details ...
A reverse primer designed from EST aa306952 (5′–CGTAACACTCCATGGAAATCAGC–3′) and a forward primer designed from the ORF upstream to EST aa306952 (5′–ATGAAGGATGTTATGTCAGCTCTGT–3′) were used to amplified ...